Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase

Summary Attributions Wiki
ECB-MORPHOLINO-24506491

Morpholino Name: sox14 MO3
Synonyms:
Target mRNA: sox14
Derived from:

Morpholino Type: translation blocking morpholino
Sequence: 5' GTCGGATGCTGGCTTTCAAAACAGA 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus
Identities 25/25
genome
MO
5' TCTGTTTTGAAAGCCAGCATCCGAC 3'
   |||||||||||||||||||||||||
3' AGACAAAACTTTCGGTCGTAGGCTG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145597.1:22023768..22023792 25/25 Antisense target sox14
Publications
First: SoxB2 in sea urchin development: implications in neurogenesis, ciliogenesis and skeletal patterning., Evodevo 2018            
Most recent:
View All Papers