Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase

Summary Attributions Wiki
ECB-MORPHOLINO-24506475

Morpholino Name: foxb1 MO2
Synonyms:
Target mRNA: foxb1
Derived from:

Morpholino Type: translation blocking morpholino
Sequence: 5' CCCCTTCTAAATAGATACAATGGTC 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: Sub-circuits of a gene regulatory network control a developmental epithelial-mesenchymal transition., Development 2014  
Most recent:
View All Papers