Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase

Summary Attributions Wiki
ECB-MORPHOLINO-24506461

Morpholino Name: arid3a MO6
Synonyms: LvDri1
Target mRNA: arid3a
Derived from:

Morpholino Type: translation blocking morpholino
Sequence: 5' GTAAAGTCTACAGACATTCGTTTGC 3'

Source: Gene Tools LLC


Target mRNA L. variegatus
Identities 25/25
genome
MO
5' GCAAACGAATGTCTGTAGACTTTAC 3'
   |||||||||||||||||||||||||
3' CGTTTGCTTACAGACATCTGAAATG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
P. miniata 3.0 NW_024037047.1:16634867..16634891 21/25 Sense off-target LOC119723794
L. variegatus 3.0 chr5:43651745..43651769 25/25 Antisense target arid3a
Publications
First: Sub-circuits of a gene regulatory network control a developmental epithelial-mesenchymal transition., Development 2014  
Most recent:
View All Papers