Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase

Summary Attributions Wiki
ECB-MORPHOLINO-24506458

Morpholino Name: pou1f1 MO1
Synonyms:
Target mRNA: pou1f1
Derived from:

Morpholino Type: translation blocking morpholino
Sequence: 5' GATATGACGGTCTCCATCTTACTCC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus
Identities 25/25
genome
MO
5' GGAGTAAGATGGAGACCGTCATATC 3'
   |||||||||||||||||||||||||
3' CCTCATTCTACCTCTGGCAGTATAG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145607.1:38654557..38654581 25/25 Sense target pou1f1
Publications
First: Brn1/2/4, the predicted midgut regulator of the endo16 gene of the sea urchin embryo., Dev Biol 2005  
Most recent: Neurogenesis in sea urchin embryos and the diversity of deuterostome neurogenic mechanisms., Development 2016  
View All Papers