Echinobase will be undergoing a hardware update June 14 and 15, 2023 and therefore will be unavailable those days.

We apologize for the inconvenience.

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase

Summary Attributions Wiki
ECB-MORPHOLINO-24506036

Morpholino Name: meis1 MO1
Synonyms: Hp-Meis-MO, HpMeis-MO1
Target mRNA: meis1

Morpholino Type: translation blocking morpholino
Sequence: 5' TCGTAACCCCTCTGTGCCATGTCGC 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus A. planci P. miniata L. variegatus
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: Meis transcription factor maintains the neurogenic ectoderm and regulates the anterior-posterior patterning in embryos of a sea urchin, Hemicentrotus pulcherrimus., Dev Biol 2018  
Most recent: cis-Regulatory analysis for later phase of anterior neuroectoderm-specific foxQ2 expression in sea urchin embryos., Genesis 2019  
View All Papers