Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Echinobase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Echinobase

Summary Attributions Wiki
ECB-MORPHOLINO-24505903

Morpholino Name: bmp2 MO2
Synonyms:
Target mRNA: bmp2
Derived from:

Morpholino Type: translation blocking morpholino
Sequence: 5' GTGGTAACCATGATGGGTCTGAAAG 3'

Source: Gene Tools LLC


Target mRNA S. purpuratus
Identities 25/25
genome
MO
5' CTTTCAGACCCATCATGGTTACCAC 3'
   |||||||||||||||||||||||||
3' GAAAGTCTGGGTAGTACCAATGGTG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
S. purpuratus 5.0 NW_022145611.1:36755834..36755858 25/25 Antisense target bmp2
Publications
First: TGFβ signaling positions the ciliary band and patterns neurons in the sea urchin embryo., Dev Biol 2010  
Most recent:
View All Papers